Ohio State University Extension Bulletin

Research and Reviews: Beef and Sheep 2001

Special Circular 181-01


Effects of Calpain and Calpastatin Genotypes on Growth of Angus Bulls

Materials and Methods

Animals

Two hundred-thirty three purebred Angus calves were born in the fall of 1995 and 1996 at the EORDC, and were fed a postweaning corn and soybean meal diet, which was formulated to meet NRC (1984) requirements for growing beef cattle. The calves were from lines divergently selected for blood serum IGF-I concentration, and were weaned at an average age of approximately 140 days.

Traits Measured

The BW, WW, ONW, W28, W42, W56, and OFW were measured. In addition, IGF-I concentration was determined on day 28 (IGF28), day 42 (IGF42), and day 56 (IGF56) of the 140-day postweaning test. Mean IGF-I concentration (average of IGF28, IGF42, and IGF56) was also calculated for each calf (IGFM).

Design of Primers

The PCR primers for CAST1 were designed based on the bovine calpastatin cDNA of domain I (Killefer and Koohmaraie, 1994; GenBank accession no. L14450 ), and primers for CAPN4L4 were based on domain IV of the calpain regulatory gene (McClelland, et al., 1989; GenBank accession no. J05065). Forward and reverse primer sequences of CAST1 were CTTGTCATCCGACTTCACCT, and TCTTCTTTTCTCTTTGGGTGGA, respectively. Forward and reverse primer sequences of CAPN4L4 were TGGCTTTGGCATTGACAC, and GCCTGCCACTTTTTGATG, respectively.

Polymorphism Detection

The PCR was conducted with a final volume of 30 mL, including 3 mL of 10 X reaction buffer (10 mM Tris, pH 8.3, 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl2 ), 10 mM dNTP, 10 pM of each primer, 50 ng of genomic DNA, and two units of Taq DNA polymerase (Gibco BRL, Grand Island, NY). After denaturation for 2 min at 95OC, PCR cycles for CAST1 were adapted to 94OC for 1 min for denaturation, 57OC for 1 min for annealing, and 72OC for 1.5 min for polymerization. Conditions for CAPN4L4 were 94 OC for 1min, 60OC for 1 min, and 72OC for 1.5 min, with a total of 35 cycles (MJ Research Inc, PTC-200, Watertown, MA). For the genotyping of all loci, 8 mL of sample was diluted with 16 mL of distilled water and 8 mL of loading buffer (0.25% bromophenol blue, 0.25% xylene cyanol FF, and 70% glycerol). After heating at 95OC for 5 min, amplification products were placed on ice. Polymorphisms for the CAST1 locus were detected by single strand conformation polymorphism (SSCP) with 1.5 x MDE (mutation detection enhancement; FMC, Rockland, ME) polyacrylamide gels. The mixture was electrophoresed in 0.5 x TBE buffer for 10 h at 250 V and 12OC. Gels were visualized by silver staining. Polymorphisms for CAPN4L4 were detected using the Hha I restriction enzyme.

Statistical Analysis

Least squares means and standard errors were determined for all measurements with a model including fixed effects of genotypes, age of dam, year (1995 and 1996), season (spring and fall), IGF-I selection line (high and low), sex of calf (bull versus heifer), and a covariate for age of calf. Analysis of variance was conducted using statistical analysis system (SAS) general linear models (GLM) procedures, and least squares means were compared using Fisher's least significant difference test (SAS, 1985) with a comparison error rate of 0.05.


Back | Forward | Table of Contents